fairfolio
Saved Projects

Comparing Lichen Phenotypic Expression with Genomic Verification

ISEF · 2018 Computational Biology and Bioinformatics

Moore, Jessica · Jasper County High School

Is this your project?

Overview

Lichen species cover nearly 8% of the earth’s surface and are overlooked in genetic studies. Because lichen are composed of bacteria, fungi, and algae, separating and sequencing a three-part genetic organism proves to be challenging. The original goal for this project was to use general fungal forward primer 5'TCCGTAGGTGAACCTGCGG 3'and the reverse primer 5’TCCTCCGCTTATTGATATGC 3' to target and replicate certain fungal genomic regions with intentions to upload a novel lichen DNA sequences into the Barcode of Life Data System (BOLD) in the Student Data Portal (SDP). Although the original primer did yield results, the genetic bands were strongly expressed on a gel electrophoresis using a gel imager, but he bioinformatic report was not reliable due to sequence interruptions. Lichen Usnea strigosa, commonly known as “Old Mans Beard” is the focus since it yielded the best sequence with the highest query reading sequence. Therefore, it was concluded that is was the best sample for DNA extraction. The focus with U. strigosa is yielding the bacterial growth on an agar plate to purify the sample before applying PCR techniques with the designed oligo bacteria primer in preparation for related specie identification. The bacteria is separated from the lichen through DNA extraction, precipitation, and proper purification. A universal bacteria DNA oligo primer, 5’ CCTACGGGRSGCAGCAG ‘3, was created to target different genomic regions of the DNA sample. The lichen sample will be sent off for sequencing and will receive the exact genetic code of “Old Mans Beard.”

Working on something like this? See what's been done and what's still open.

Competition history

Resources

Related projects

Closest projects by meaning, across every fair and year in the corpus.

Browse more like this

Report a problem

Source: Regeneron International Science and Engineering Fair

Save projects to your library

Sign in with Google to keep track of projects you find interesting, organized into folders. An account also raises your daily allowance for “Has this been done?”, and lets you create a key for the MCP server with a much higher limit than anonymous use. Browsing stays public.

Continue with Google