Radiation to Mutation
CYSF · 2025
Overview
Testing the effects of UV radiation on mutagenesis in E. coli
Hypothesis
Hypothesis:
Aida Banerjee
If E. coli is exposed to UV light for 1 hour, then any mutations that occurred will be reversed in the chosen genes of E. coli (lon, dnaG, sulA, recF). This is because the SOS response, which repairs damaged and mutated DNA, is upregulated every 30, 60, and 100 minutes. This allows the SOS response to repair any damaged DNA in the 60 minute timeframe, without the unmanageable stress of continuous radiation. Meanwhile, if E. coli is exposed to UV light for 24 hours, then the SOS response will not have sufficient time to repair the DNA, as it will be under the ongoing stress of radiation while in the exponential phase of growth. As a result, CC to TT tandem mutations, which are a common mutation caused by exposure to UV light, will be observed in lon, sulA, and recF. The genes, sulA and lon are very sensitive to UV light, making them susceptible to these mutations. Also, lon and sulA are very closely connected because the product of sulA is degraded by lon. In addition, recF is a recombination mediator protein that causes a delay in the SOS response when mutations of the gene are caused by UV radiation. It is yet another gene that is sensitive to UV radiation, and upon its mutation, can affect the entire SOS response. The final gene, dnaG, is not hypothesized to form CC to TT tandem mutations because it is not involved in the SOS response and does not display any sensitivity towards UV radiation.
Research
Background Research:
Aida Banerjee
Mutations
Genetic mutations are a change in an organism’s genetic material. Mutations can be spontaneous, naturally induced by a mutagen, result from an error in DNA replication, or engineered using techniques such as PCR (polymerase chain reaction). These mutations are instrumental in evolution of all organisms, but can lead to cancer and other genetic diseases6.
A point mutation occurs when a single base pair is changed, deleted, or added to a genetic sequence. Point mutations, although seemingly simple, can result in many different issues and conditions. For example, sickle cell anemia in humans is caused by a single base pair mutation6.
Yet another type of mutation is a missense mutation. This is when a nucleotide substitution changes an amino acid. Among varying consequences, it can lead to altered protein function6.
Mutagenesis can also be due to stress. An organism may undergo mutations due to a stressful environment, which may prove advantageous for the organism. This is true for Escherichia coli (E. coli), among other organisms16. This stress response helps bacteria survive extreme environments because mutations can better equip them for survival12.
UV (Ultraviolet) radiation is an exogenous cause of mutation. UV damage can cause pyrimidine dimers and pyrimidine-pyrimidone photoproducts, which distort the DNA helix. Pyrimidine dimers are major lesions, and are most commonly caused by exposure to UVB light. These dimers cause C:G to T:A, T:A to C:G, and tandem CC to TT transition mutations, which are affiliated with UV induced mutations6.
Skin Cancer
UV light is a known cause of many types of skin cancers and skin conditions. Some serious skin conditions, such as xeroderma pigmentation, are caused by genetic defects in the XP (ERCC) genes in repair pathways. Xeroderma pigmentation results in high sensitivity to sunlight and predisposition to cancer2.
Additionally, basal cell carcinoma and squamous cell carcinoma are types of cancers also caused by genetic mutations. In squamous cell cancers, the TP53 tumor suppressor gene is altered, and allows abnormal cells to grow and duplicate. Basal cell cancers are mainly caused by mutations in the tumor suppressor genes, PTCH1 or PTCH2. Alterations in these genes cause cell growth to become out of control2.
These examples demonstrate how genetic mutations can be very closely related to many skin conditions and cancers.
E. Coli as a Model Organism
E. coli can be used as a model organism for this project because there are many genes that have homologous functions to genes in the human body considering synthesis, repair, and stress response of DNA. Similarly, pyrimidine dimers and other lesions occur in both E. coli and human cells. These lesions are repaired by similar repair pathways and recombination mediator proteins with homologous roles in both organisms13. Another similarity is that the genomic DNA of the E. coli is being tested, which would be the type of DNA undergoing mutation in a human cell.
lon
The lon gene in E. coli is responsible for the degradation of misfolded proteins and rapidly degraded regulatory proteins11. It enforces protein quality control and modifies protein composition. Lon also plays a minor role in physiological disintegration of inclusion bodies. Inclusion bodies are proteins, usually but not always, expressed from foreign or mutated genes. Along with this, it may repair DNA lesions resulting from exposure to high quinolone concentrations10.
In a study on bladder and colon cancer models in mice, Lon protease was used to degrade the oncogene MYC. The results showed a promising future for targeting of c-MYC using lon3.
I chose to test this gene because of its success degrading the MYC oncogene, and because of its role in protein mediation.
dnaG
DnaG catalyzes synthesis of RNA primers on a single-stranded template. This is the starting point for DNA synthesis. DnaG initializes DNA replication in plasmids and phages, along with encoding primase protein. Encoding primase protein initiates the leading and lagging strands of DNA5.
The enzyme, DNA primase binds three distinct sites during priming. This gene is quintessential for beginning DNA replication, and the availability of its enzyme determines how frequently new fragments are started and also controls their length5.
I chose to test this gene in this experiment because replication errors can cause breaks in DNA. If dnaG is mutated, many replication errors will occur as a result9. In humans, replication errors can lead to cancer due to fragments of chromosomes rearranging themselves and activating oncogenes. Oncogenes undergo rapid cell division, and pose a threat of developing cancer. This concept can be related to this gene, dnaG, because it is very similar to genes in humans which are part of the replication process8.
sulA
SulA inhibits cell division as part of the SOS response, which regulates mutated genes. When inhibiting cell division, it also blocks Z ring formation. The Z ring controls DNA replication, and by preventing its formation, SulA is able to act as a part of the SOS response to repair any DNA damage15.
A sulA mutant was initially isolated as a suppressor of UV sensitivity of a Lon mutant. This means that the sulA gene is thought to protect the UV sensitive Lon gene from mutation. Additionally, Lon degrades sulA, which seems to be the reason for the short half life of the SulA protein (10 minute in vivo half life)15.
Mutations in the cell that make it resistant to the sulA gene map to FtsZ. FtsZ is a cell division protein that is the cellular target of sulA when initializing the SOS response. Polymerization of FtsZ creates Z rings15.
This gene is important to my experiment because its expression is induced by UV radiation, and it belongs to a group of genes which facilitate stress-induced mutagenesis1. This is the transient mutator state that induces bacteria for genetic change. sulA is a key gene in regulating mutations in E. coli, and analyzing the effects of UV radiation on this gene is very important to understanding the role of SOS response and its effectiveness15.
recF
RecF is a recombination mediator protein. These proteins load the protein RecA onto single stranded DNA. RecA is essential for the maintenance and repair of bacterial DNA14. Homologs to RecA have been found in all types of organisms, including humans4.
RecF functions at the early stage of recombinational repair, and promotes recombinational repair of double-stranded DNA breaks9. The RecF pathway aims for homology-directed repair of post-replicative single-stranded DNA gaps14.
I chose to study recF primarily for its role in repairing damaged DNA as a recombination mediator protein, but also because of its connections to UV radiation. RecF colocalizes with replisomes, which are complex molecules that replicate DNA, before and after UV damage14. Also, mutations in recF delay the SOS response following UV radiation. Mutations in recF also result in a high cell lethality. It is a very UV sensitive gene, and a very important gene in the repair process4.
RecF is also being explored as an option for cancer treatment. This is because as a recombination mediator protein, its role in repairing DNA could be very important in cancer therapies4.
PCR
PCR (Polymerase Chain Reaction) is a procedure used to rapidly make copies of a specific DNA sequence. Multiple rounds of DNA synthesis are conducted and primers are used to amplify certain sections of the genome. It involves temperature changes to separate the DNA helix, bind the primers to the DNA, and activate the enzyme.
Gel Electrophoresis
Gel electrophoresis is a process used to separate DNA based on molecular size and electrical charge. An electric current moves molecules through an agarose gel containing small pores, and the larger fragments stay at the top of the gel, while the smaller ones move further through the gel. This is typically used with PCR to analyze DNA amplification7.
Importance
The results of this experiment on E. coli are useful in learning more about the effects of UV light on skin cells, which could lead to cancer. This is because the genes Lon, dnaG, sulA, and recF have many similar characteristics and functions to genes in human skin cells. When these genes are mutated, it can lead to errors in gene expression, such as replication errors, recombination errors, errors in the SOS response, and protein synthesis errors. These faults can all contribute to uncontrollable cell division, and as a result, various types of skin cancer. Using the information collected in this experiment, it will be evident which genes mutate due to the UV light exposure, and the type of mutations that are caused. This data can then be used to develop technologies and medicine to prevent genetic mutations and skin cancer.
Bibliography
1. Abdelwahed EK, Hussein NA, Moustafa A, Moneib NA, Aziz RK. Gene networks and pathways involved in escherichia coli response to multiple stressors. Microorganisms. September 6, 2022. Accessed February 6, 2025. https://pmc.ncbi.nlm.nih.gov/articles/PMC9501238/.
2. Basal and squamous cell skin cancer causes: What causes skin cancer? Basal and Squamous Cell Skin Cancer Causes | What Causes Skin Cancer? | American Cancer Society. Accessed February 4, 2025. https://www.cancer.org/cancer/types/basal-and-squamous-cell-skin-cancer/causes-risks-prevention/what-causes.html.
3. Butler DSC, Cafaro C, Putze J, et al. A bacterial protease depletes c-myc and increases survival in mouse models of bladder and colon cancer. Nature News. February 11, 2021. Accessed February 4, 2025. https://www.nature.com/articles/s41587-020-00805-3.
4. Courcelle J, Worley TK, Courcelle CT. Recombination mediator proteins: Misnomers that are key to understanding the genomic instabilities in cancer. MDPI. February 27, 2022. Accessed February 6, 2025. https://www.mdpi.com/2073-4425/13/3/437#:~:text=Recombination%20mediator%20proteins%20have%20come,treating%20cancers%20with%20microsatellite%20instabilities.
5. dnaG - DNA Primase - Escherichia coli. Escherichia coli K-12 substr. MG1655 dnag. Accessed February 6, 2025. https://biocyc.org/gene?orgid=ECOLI&id=EG10239#showAll.
6. Durland J. Genetics, mutagenesis. StatPearls [Internet]. September 19, 2022. Accessed February 2, 2025. https://www.ncbi.nlm.nih.gov/books/NBK560519/.
7. Gel Electrophoresis. Nature news. Accessed February 6, 2025. https://www.nature.com/scitable/definition/gel-electrophoresis-286/#:~:text=Gel%20electrophoresis%20is%20a%20laboratory,gel%20that%20contains%20small%20pores.
8. JR; BR. Isolation and characterization of suppressors of two escherichia coli dnag mutations, DNAG2903 and parb. Genetics. Accessed February 6, 2025. https://pubmed.ncbi.nlm.nih.gov/9093842/.
9. Keeping DNA replication in check. Center for Cancer Research. Accessed February 6, 2025. https://ccr.cancer.gov/news/milestones-2019/article/keeping-dna-replication-in-check#:~:text=DNA%20replication%20errors%2C%20especially%20those,lead%20to%20uncontrollable%20cell%20division.
10. Lon - Lon Protease. Escherichia coli K-12 substr. MG1655 Lon. Accessed February 4, 2025. https://biocyc.org/gene?orgid=ECOLI&id=EG10542.
11. lon - Lon protease - Escherichia Coli. UniProt. Accessed February 4, 2025. https://www.uniprot.org/uniprotkb/P0A9M0/entry.
12. Lukačišinová M, Novak S, Paixão T. Stress-induced mutagenesis: Stress diversity facilitates the persistence of mutator genes. PLOS Computational Biology. Accessed February 6, 2025. https://journals.plos.org/ploscompbiol/article?id=10.1371%2Fjournal.pcbi.1005609.
13. Pyrimidine dimer. Pyrimidine Dimer - an overview | ScienceDirect Topics. Accessed February 4, 2025. https://www.sciencedirect.com/topics/pharmacology-toxicology-and-pharmaceutical-science/pyrimidine-dimer.
14. recF - recombination mediator protein RecF - Escherichia Coli. Escherichia coli K-12 substr. MG1655 RECF. Accessed February 6, 2025. https://biocyc.org/gene?orgid=ECOLI&id=EG10828.
15. sulA - cell division inhibitor SulA - Escherichia Coli. Create account. Accessed February 6, 2025. https://biocyc.org/gene?orgid=ECOLI&id=EG10984.
16. Watford S. Bacterial DNA mutations. StatPearls [Internet]. April 10, 2023. Accessed January 30, 2025. https://www.ncbi.nlm.nih.gov/books/NBK459274/.
Variables
Variables:
Aida Banerjee
The manipulated variable in this study is the exposure to UV light (exposure for 1 hour/overnight/ no exposure). The responding variable is the mutations observed in the 4 genes tested (Lon, dnaG, sulA, recF). The controlled variables are the same time of exposure to the UV light and the same frequency of UV light, the same strain of E. coli, and the same growing conditions (shaking incubator overnight at 37℃). Confounding variables include contamination of the bacteria, and quality of the primers.
Procedure
Methodology:
Aida Banerjee
Grow Escherichia Coli (E. Coli)
The HB101 K-12 strain of E. coli was grown using Luria-Bertani (LB) Broth. It was grown overnight in a shaking incubator at 37℃.
Purification with Bio-Rad Genomic DNA Extraction Kit
The Bio-Rad Genomic DNA Extraction Kit (Bio-Rad, 2025)was used as a first attempt to extract the gDNA of the E. coli. This kit is intended for plant cells, but it was attempted to be optimized for E. coli cells. Two samples were purified.
First, the bacteria was separated from the LB Broth by centrifuging the sample for 1 minute at full power. Then, 500 microlitres of lysis solution was added and suspended. To break down the cell, it was centrifuged for 5 minutes at high power. Next, 400 microlitres of the supernatant was added to 500 microlitres of 70% ethanol, taking precautions to not disturb the pellet of cell debris at the bottom of the microcentrifuge tube. The lysate and ethanol were mixed by pipetting up and down. 800 of the 900 microlitres of bacterial lysate was transferred to a capless collection tube, and was centrifuged for 1 minute; the flow through was discarded. This removes any remaining cellular debris. Then, 700 microlitres of wash buffer were added to both samples. They were centrifuged for three 1 minute intervals at high power. After the final wash, the flow through was discarded and the columns were dried by centrifuging at full speed for 2 minutes. The samples were transferred to capped microcentrifuge tubes and 80 microlitres of 70℃ sterile water were added to each column, and they sat for 1 minute. The columns were spun for 2 minutes. This is to purify the DNA. The purified nucleic acid was stored at 20℃.
Gel Electrophoresis
To load the gel for the gel electrophoresis, 0.4 grams of agarose was dissolved in 50 milliliters of the Bio-Rad TAE (Tris/Acetic Acid/EDTA) buffer (Bio-Rad, 2025). This made a 0.8% agarose gel (0.8g/100 mL). To dissolve the agarose, the solution was microwaved in intervals for around 1 minute. Once the solution had cooled, it was poured on the gel casting mould overnight to solidify. After the gel solidified, the DNA samples were centrifuged to thaw them. Then, 2 microlitres of the Bio-Rad Uview loading dye (Bio-Rad, 2025) was added to 10 microlitres of purified genomic DNA. 10 microlitres of the resulting solution was loaded onto the gel, and the rest was discarded. Molecular weight marker was loaded into another well to serve as a guide for analysis. The gel was run for 30 minutes at 200V. The gel was analyzed, and showed no DNA.
Grow E. Coli
A second sample of E. coli was grown using the same method as stated before. This is for the second attempt at purification.
Purification with Instagene Matrix
As a second attempt to extract the genomic DNA from the E. coli cell, the Bio-Rad Instagene Matrix (Bio-Rad, 2025) was used. This matrix binds to all lysis from the cell except the DNA. First, the E. coli was centrifuged for 1 minute at 12000 RPM and the supernatant was removed. 200 microliters of the matrix was added to the E. coli using the 1000 microliter pipet tip. Next, it was incubated at 56℃ for 30 minutes and vortexed at high speed for 10 seconds. It was then placed in a boiling (100℃) water bath for 8 minutes. The supernatant was then vortexed again at high speed for 10 seconds and centrifuged at 12000 RPM for 2 minutes. The supernatant was stored at -20℃.
Ordering Lon Primers
The oligos for the Lon gene were designed and ordered through the company, Integrated DNA Technologies.
Figure 1: Lon Primer Sequences
RefSeq (Reference Sequence) | Forward Sequence | Reverse Sequence
XM_069504215.1 | AGATGGCGTGAAGCACAGTC | CCCGATCCGCCATCTAACTT
Lon PCR 1
To prepare the primers for PCR, 1230 microlitres of sterilized water was added to the Lon primer, and 1410 microlitres was added to the Lon Reverse primer.
The controls used in this PCR were gAra (Genomic DNA Arabidopsis Thaliana) and pGAP, a control plasmid that contains the gene of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Bio-Rad GAPDH primers (Bio-Rad, 2025)were used for the controls. These are degenerate primers that bind to variations of GAPDH genes and Arabidopsis family genes. The gAra was diluted 1:5, with 2 microlitres of gAra and 8 microlitres of water. The GAPDH primers were diluted 1:50 with Bio-Rad’s Master Mix 2X (MM2X)(Bio-Rad, 2025). This contains the polymerase dNTPs buffer and enzyme. 2 microlitres of the GAPDH primer was diluted with 98 microlitres of the MM2X. Additionally, a control with a template of water was used for each primer.
The Lon and Lon Reverse primers were diluted 1:50 with 2 microlitres of each primer and 96 microlitres of the MM2X.
These PCR reactions were run in the thermal cycler (PCR machine). The program heated the samples to 95℃ for 5 minutes to separate the gDNA. Then, it remained at 95℃ for another minute and decreased to the annealing temperature for the primers for a minute, which is 56℃. Next, the samples were heated to 72℃ for 2 minutes for the enzyme to replicate the DNA. Steps 2-4 were repeated 40 times and the PCR reactions rested at 12℃.
Figure 2: Lon 1 PCR Reactions
| 1 | 2 | 3 | 4 | 5 | 6
Template | 5 μL H 2 O | 5μL gAra | 5μL pGAP | 5 μL H 2 O | 10μL gEco (gDNA of E. coli sample) | 20μL gEco
H 2 O | 15μL | 15 μL | 15 μL | 15 μL | 10μL | N/A
Primers | 20μL GAPDH primer (+MM2X) | 20μL GAPDH primer (+MM2X) | 20μL GAPDH primer (+MM2X) | 20μL Lon primers (+MM2X) | 20μL Lon primers (+MM2X) | 20μL Lon primers (+MM2X)
Total | 40 μL | 40μL | 40μL | 40μL | 40μL | 40μL
Gel Electrophoresis
The gel was made using the same procedure as stated above, but instead, a 1% agarose gel (1 g/100 mL) was made. All 6 PCR samples were prepared for the electrophoresis by mixing 10 microlitres of each sample with 2 microlitres of the loading dye. In one well, the crude gDNA from the E. coli sample with loading dye was loaded. The eighth, and last, well was for the molecular weight marker. This gel ran for 80 minutes at 120V.
The gel was analyzed and showed that the pGAP control worked, and there were slight bands of small material in the gEco samples. However, these are too small to be the gene.
Lon PCR 2
In this round, the previous PCR samples of the gEco were attempted to be optimized as templates in this PCR with a lower annealing temperature.
For the second round of Lon PCR, the same steps were taken to prepare the MM2X and GAPDH primers, and the MM2X and Lon primers. The same controls were used, and the primers had already been prepared for the previous PCR.
The program was the same, except the annealing temperature for the primers was lowered to 50℃.
Figure 3: Lon 2 PCR Reactions
| 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8
Template | 5 μL H 2 O | 5μL gAra | 5μL pGAP | 5 μL H 2 O | 10μL gEco (gDNA of E. coli sample) | 20μL gEco | 10μL Lon PCR 1 - Reaction 5 | 10μL Lon PCR 1 - Reaction 6
H 2 O | 15μL | 15 μL | 15 μL | 15 μL | 10μL | N/A | 10μL | 10μL
Primers | 20μL GAPDH primer (+MM2X) | 20μL GAPDH primer (+MM2X) | 20μL GAPDH primer (+MM2X) | 20μL Lon primers (+MM2X) | 20μL Lon primers (+MM2X) | 20μL Lon primers (+MM2X) | 20μL Lon primers (+MM2X) | 20μL Lon primers (+MM2X)
Total | 40 μL | 40μL | 40μL | 40μL | 40μL | 40μL | 40μL | 40μL
Gel Electrophoresis
A 1% agarose gel was made and all 8 PCR reactions were loaded with the loading dye into the gel. Additionally, one extra sample of the pGAP was loaded, because it was a successful control previously. The molecular weight marker was loaded twice as well, because this gel had two rows to fit each sample. The gel was run for 150 minutes at 120V.
The pGAP was successful again, and the previous PCR samples 5 and 6 showed some small bands again, but nothing big enough to be the gene.
Ordering recF Primers
The oligos for the recF gene were designed and ordered through the company, Integrated DNA Technologies.
Figure 4: recF Primer Sequences
RefSeq | Forward Sequence | Reverse Sequence | Product Length
NP_418155.1 | GCATCCAGCCCTTTCAGGAC | CGCATGATGCTGACCGATTAC | 1247
recF PCR
PCR was run on another gene that was planned to be tested, recF. This was to collect more data to determine why the Lon PCRs were unsuccessful.
The previous dilution of the MM2X with the GAPDH primer was used, and the recF primers were diluted 1:50 for each primer with the MM2X by using 2 microlitres of each primer and 96 microlitres of the MM2X. The previous dilution of the gAra was also used as a control. pGAP and water templates were also used as controls like the previous Lon PCRs.
The same program for the Lon PCR was used for the recF PCR, but the annealing temperature for the primers was changed to 53℃.
Figure 5: recF PCR Reactions
| 1 | 2 | 3 | 4 | 5 | 6
Template | 5 μL H 2 O | 5μL gAra | 5μL pGAP | 5 μL H 2 O | 10μL gEco (gDNA of E. coli sample) | 20μL gEco
H 2 O | 15μL | 15 μL | 15 μL | 15 μL | 10μL | N/A
Primers | 20μL GAPDH primer (+MM2X) | 20μL GAPDH primer (+MM2X) | 20μL GAPDH primer (+MM2X) | 20μL recF primers (+MM2X) | 20μL recF primers (+MM2X) | 20μL recF primers (+MM2X)
Total | 40 μL | 40μL | 40μL | 40μL | 40μL | 40μL
Gel Electrophoresis
One again, a gel was made using the same procedure as the previous times. A 1% agarose gel was made.
All 6 samples were loaded with the loading dye into the gel, and it was run for 90 minutes at 150V. The molecular weight marker was also run.
The pGAP control was successful, but again, the gAra wasn’t. All samples that used the recF primers, including the water templates, showed very small bands lower down the gel. This is hypothesized to be primer dimers, and is not the full gene.
Observations
Results:
Aida Banerjee
Purification with Bio-Rad gDNA Extraction Kit
As is presented in this gel, no DNA was extracted and purified using the Bio-Rad gDNA Extraction Kit (Bio-Rad, 2025).
Lon PCR 1
Bands of lower than 2000 base pairs appeared in the pGAP control (sample 3), but in none of the other controls (1,2, and 4). Very slight bands lower than 2000 base pairs appeared in the sample of crude genomic DNA from the E. coli. No bands appeared in either of the E. coli PCR samples (5 and 6).
Lon PCR 2
Similar to the previous PCR, bands just below 4000 base pairs appeared in the pGAP control (sample 3). The samples with the previous Lon PCR samples as templates (samples 7 and 8) showed small bands around 2000 base pairs. All other controls and E. coli samples did not show any DNA bands.
recF PCR
The results displayed in the gel from the recF PCR are very similar to the results from both rounds of Lon PCR. There are bands lower than 2000 base pairs in the pGAP control sample (sample 3). Also, there are very small bands lower than 2000 base pairs in both the E. coli samples (5 and 6) and the water control with recF primers (sample 4). Samples 4, 5, and 6 all used recF primers. The water control sample (1) and gAra sample (2) showed no bands.
Analysis
Analysis:
Aida Banerjee
Purification with Bio-Rad gDNA Extraction Kit
The absence of bands in both of the E. coli samples indicates that the purification attempt was unsuccessful. It can be concluded that the attempt was unsuccessful because this kit was intended to be used for plants. Likely, it cannot be optimized for the purification of bacterial DNA.
Lon PCR 1
The band lower than 2000 base pairs displayed by the pGAP control (sample 3) indicates that this was a successful control. The other positive control, gAra (sample 2) was not successful. This could be due to an incorrect primer annealing temperature, or another condition of the thermal cycler. The reason for its unsuccess is undetermined. The negative controls, the water templates (1 and 4), both did not show any bands, so these controls were accurate. The E. coli PCR samples (5 and 6) did not show any bands, which was unexpected. This could be due to many reasons, such as a problem with the primers, crude gDNA, or the conditions of the PCR. Another round of Lon PCR was conducted to determine the reason for its unsuccess (see below). Slight bands of the gDNA E. coli sample showed up in the gel, but they are too small to be the genome or even a large part of it. Due to these results from the gDNA sample of E. coli, questions arise about the purification about the crude gDNA. To test these, another round of PCR was conducted (see below).
Lon PCR 2
Similar results to the first PCR are displayed in the second round. During the second round of PCR, the primer annealing temperature was lowered to 50℃ from 56℃. Bands of the pGAP control (sample 3) are seen at 4000 base pairs, slightly larger than the bands seen in the gel electrophoresis from the last round, which were around 2000 base pairs. This is likely because the gel was run for a longer time this round, causing discrepancies. All the other controls, positive and negative, were unsuccessful (samples 1,2,4). This aligns with the previous results, because the annealing temperature was only lowered 6 degrees. The reasons for the gAra (sample 2) being unsuccessful are unknown, but are hypothesized to be the same reasons as Lon PCR 1. The E. coli PCR samples 5 and 6 were also unsuccessful, and showed no bands. These were done the same as the round before, only the annealing temperature was lower. Samples 7 and 8 used the previous PCR samples of E. coli as templates. These samples displayed some very low bands of DNA lower than 2000 base pairs. This is too small to be the Lon gene, and are hypothesized to be primer dimers, because of the excess primers already in the template of the samples.
recF PCR
The pGAP control (sample 3) was also successful in this round of PCR, with bands lower than 2000 base pairs. The water control with GAPDH primers (sample 1) was unsuccessful like it was expected, and the gAra (sample 2) did not work for this round of PCR either. This is likely due to the annealing temperature or other conditions of the PCR. The water control with recF primers displayed some very slight bands a lot smaller than 2000 base pairs. There were similar bands in both of the E. coli samples with recF primers (samples 5 and 6). This is hypothesized to be primer dimers as they appeared in all three of the samples with recF primers. These dimers form when primers bind to each other and not to the target template. In this case, it is hypothesized that the crude genomic DNA of the E. coli was not purified correctly, and resulted in the primers binding to themselves.
Conclusion
Conclusion:
Aida Banerjee
From the results of my experiment, it can be concluded that the likely cause for the unsuccessful results of the experiment was that the crude gDNA was not extracted and purified properly from the E. coli cell. Due to this, primer dimers were created because the primers did not have a sufficient template of gDNA from the E. coli to bind to. The kit that was used in this experiment was the Bio-Rad Instagene Matrix (Bio-Rad, 2025). This is not a traditional method for purification, as the lysis binds to the matrix, leaving the DNA. As a result, the DNA is not as pure as traditional kits. This is likely the reason for its unsuccess. It can also be concluded that there may have been some problems with the primers or the annealing temperature of the primers due to the fact that primer dimers were found even in the water template with recF primers. Finally, due to the time and resource constraints that limited the amount of PCR rounds that could be done, only three rounds of PCR could be conducted in attempts to optimize the conditions for the E. coli samples. Usually, in experiments involving PCR, multiple rounds are conducted to determine the correct conditions for the experiment. Overall, the crude gDNA of the E. coli was the root problem in the failure of this experiment, but with more time and resources, this experiment could be conducted successfully.
Application
Applications:
Aida Banerjee
Real-World Applications
The results of this experiment are very useful in learning about the effects of UV radiation on skin cells, which is a leading cause of skin cancer. All the genes tested in this experiment are homologous or have similar functions to genes in human skin cells, and the mutations observed in these chosen genes will likely occur in human genes too. This allows for a further understanding of how UV radiation affects skin cells and the human genome. Through the results of this experiment, it will be evident which genes mutate due to UV light, and what mutations occur. From these results, technologies and medicine can be created to prevent genetic mutations and skin cancer.
Further Applications of Experiment
To make this experiment successful, a traditional method of purification would be used to purify the genomic DNA, instead of the Bio-Rad Instagene Matrix (Bio-Rad, 2025). This is because the kit that was used was a non-traditional method that was not effective in the purification of the DNA. A traditional kit would result in purer DNA because the kit extracts the DNA from the lysis of the cell, meanwhile the kit that was used extracts all the lysis of the cell and leaves the DNA. Another further application would be to use degenerate primers instead of specific primers. This ensures the primers will bind to the DNA, in the case that the DNA extracted is mutated in the flanking regions of the selected genes. If specific primers are used and the flanking regions of the genes are mutated, then the primers will not bind to the necessary sequence.
Sources Of Error
Sources of Error:
Aida Banerjee
The main source of error in this experiment was the unsuccessful purification of the DNA using the Bio-Rad Instagene Matrix (Bio-Rad, 2025). This was a non-traditional way of purification, and resulted in impure DNA. Another source of error was possible contamination of the PCR reactions, as displayed in the faint bands presented in the gel electrophoresis. These faint bands could have also been primer dimers, which could have also been caused by insufficient primers.
Citations
Bibliography
1. Abdelwahed EK, Hussein NA, Moustafa A, Moneib NA, Aziz RK. Gene networks and pathways involved in escherichia coli response to multiple stressors. Microorganisms. September 6, 2022. Accessed February 6, 2025. https://pmc.ncbi.nlm.nih.gov/articles/PMC9501238/.
2. Basal and squamous cell skin cancer causes: What causes skin cancer? Basal and Squamous Cell Skin Cancer Causes | What Causes Skin Cancer? | American Cancer Society. Accessed February 4, 2025. https://www.cancer.org/cancer/types/basal-and-squamous-cell-skin-cancer/causes-risks-prevention/what-causes.html.
3. Butler DSC, Cafaro C, Putze J, et al. A bacterial protease depletes c-myc and increases survival in mouse models of bladder and colon cancer. Nature News. February 11, 2021. Accessed February 4, 2025. https://www.nature.com/articles/s41587-020-00805-3.
4. Courcelle J, Worley TK, Courcelle CT. Recombination mediator proteins: Misnomers that are key to understanding the genomic instabilities in cancer. MDPI. February 27, 2022. Accessed February 6, 2025. https://www.mdpi.com/2073-4425/13/3/437#:~:text=Recombination%20mediator%20proteins%20have%20come,treating%20cancers%20with%20microsatellite%20instabilities.
5. dnaG - DNA Primase - Escherichia coli. Escherichia coli K-12 substr. MG1655 dnag. Accessed February 6, 2025. https://biocyc.org/gene?orgid=ECOLI&id=EG10239#showAll.
6. Durland J. Genetics, mutagenesis. StatPearls [Internet]. September 19, 2022. Accessed February 2, 2025. https://www.ncbi.nlm.nih.gov/books/NBK560519/.
7. Gel Electrophoresis. Nature news. Accessed February 6, 2025. https://www.nature.com/scitable/definition/gel-electrophoresis-286/#:~:text=Gel%20electrophoresis%20is%20a%20laboratory,gel%20that%20contains%20small%20pores.
8. JR; BR. Isolation and characterization of suppressors of two escherichia coli dnag mutations, DNAG2903 and parb. Genetics. Accessed February 6, 2025. https://pubmed.ncbi.nlm.nih.gov/9093842/.
9. Keeping DNA replication in check. Center for Cancer Research. Accessed February 6, 2025. https://ccr.cancer.gov/news/milestones-2019/article/keeping-dna-replication-in-check#:~:text=DNA%20replication%20errors%2C%20especially%20those,lead%20to%20uncontrollable%20cell%20division.
10. Lon - Lon Protease. Escherichia coli K-12 substr. MG1655 Lon. Accessed February 4, 2025. https://biocyc.org/gene?orgid=ECOLI&id=EG10542.
11. lon - Lon protease - Escherichia Coli. UniProt. Accessed February 4, 2025. https://www.uniprot.org/uniprotkb/P0A9M0/entry.
12. Lukačišinová M, Novak S, Paixão T. Stress-induced mutagenesis: Stress diversity facilitates the persistence of mutator genes. PLOS Computational Biology. Accessed February 6, 2025. https://journals.plos.org/ploscompbiol/article?id=10.1371%2Fjournal.pcbi.1005609.
13. Pyrimidine dimer. Pyrimidine Dimer - an overview | ScienceDirect Topics. Accessed February 4, 2025. https://www.sciencedirect.com/topics/pharmacology-toxicology-and-pharmaceutical-science/pyrimidine-dimer.
14. recF - recombination mediator protein RecF - Escherichia Coli. Escherichia coli K-12 substr. MG1655 RECF. Accessed February 6, 2025. https://biocyc.org/gene?orgid=ECOLI&id=EG10828.
15. Schwartz, N. (2003). Bio-Rad Laboratories. California: Hercules.
16. sulA - cell division inhibitor SulA - Escherichia Coli. Create account. Accessed February 6, 2025. https://biocyc.org/gene?orgid=ECOLI&id=EG10984.
17. Watford S. Bacterial DNA mutations. StatPearls [Internet]. April 10, 2023. Accessed January 30, 2025. https://www.ncbi.nlm.nih.gov/books/NBK459274/.
Acknowledgement
Acknowledgement:
Aida Banerjee
I would like to acknowledge Dr. Beatriz Garcia and Jessica Xiang for their guidance, mentorship, and supervision during the entirety of this project. Additionally, I would like to thank Jessica for the designing the primers. I would also like to acknowledge my parents for their support and for purchasing all of the necessary materials and the primers.
Images (8)
Awards (1)
- BRONZE
Competition history
- CYSF 2025
Resources
- Presentation
- Not working? Open in a new tab.
- https://www.cancer.org/cancer/types/basal-and-squamous-cell-skin-cancer/causes-risks-prevention/what-causes.html
- https://www.mdpi.com/2073-4425/13/3/437#:~:text=Recombination%20mediator%20proteins%20have%20come,treating%20cancers%20with%20microsatellite%20instabilities
- https://biocyc.org/gene?orgid=ECOLI&id=EG10239#showAll
- https://www.nature.com/scitable/definition/gel-electrophoresis-286/#:~:text=Gel%20electrophoresis%20is%20a%20laboratory,gel%20that%20contains%20small%20pores
- https://pubmed.ncbi.nlm.nih.gov/9093842/
- https://www.uniprot.org/uniprotkb/P0A9M0/entry
- https://biocyc.org/gene?orgid=ECOLI&id=EG10984
- View Log Book (may download a file)
Related projects
ISEF · 2019
Resisting the Nucleotide in Oligonucleotide-Directed Mutagenesis
CWSF · 2026
Threshold-Dependent Collapse of Escherichia Coli Survival Under Ultraviolet Radiation
ISEF · 2017
Investigating the Effects of UV Radiation on Yeast Colony Growth
ISEF · 2016
The Impact of Ultraviolet Radiation on DNA Repair-Deficient Yeast
ISEF · 2017
Drosophila melanogaster’s Mutant Reaction to UV Radiation with a Link to the p53 Gene
ISEF · 2016
The Effects of Expressing DNA Repair Enzymes, UVDE and cv-pdg, in E. coli cells under UVB Light
ISEF · 2017
Mutagenesis of Soil Bacteria for Life on Mars
ISEF · 2020
Directed Radioresistance via Genetic Engineering (Year V)
Closest projects by meaning, across every fair and year in the corpus.
Source: Calgary Youth Science Fair